Methods to Calculate Melting Temperature (Tm) for Primers
The melting temperature (Tm) is the temperature at which half of a double-stranded DNA molecule becomes single-stranded (denatured) and the remaining half becomes double-stranded (annealed with its complement).
The Tm parameter is critical for the overall success of PCR/qPCR, northern and southern blots, and sequencing experiments. The optimal Tm range from 52-58 °C (but can be also relaxed to 45-65 °C).
The incorrect calculation of Tm could lead to the amplification of non-specific products, mispriming, and problems with hybridization.
The following methods can be used to get the approximate Tm value for the primer sequences.
Basic method (for sequences < 14 nt)
The following equation gives approximate Tm value and is generally valid for the short primer sequences (e.g. < 14 nt or < 20 nt)
Where, kA, kT, kG, and kC are the number of A, T, G, and C nucleotides, respectively.
This equation assumes that the annealing occurs under standard conditions (50 nM of primer concentration, pH ~7.0, and 50 mM Na+).
For example, if you have a sequence ATGCTAGGGTAC, you can calculate the Tm using this method as follows:
Tm = (3 + 3)*2 + (4 + 2)*4 = 36
The Tm of the sequence ATGCTAGGGTAC is 36°C
Basic method (for sequences > 13 nt)
The following equation gives approximate Tm value and is generally valid for longer primer sequences (e.g. > 13 nt) ).
Where, kA, kT, kG, and kC are the number of A, T, G, and C nucleotides, respectively.
This equation assumes that the annealing occurs under standard conditions (50 nM of primer concentration, pH ~7.0, and 50 mM Na+).
For example, if you have a sequence ATGCTAGGGTACTGACTAAGCCTA, you can calculate the Tm using this method as follows:
Tm = 64.9 + 41.0 * (6 + 5 - 16.4) / (7 + 6 + 6 + 5) = 64.9 - 9.225 = 55.67
The Tm of the sequence ATGCTAGGGTACTGACTAAGCCTA is 55.67°C
Salt adjusted method (for sequences > 13 nt)
This method adjusts the Tm for salt concentration,
This equation assumes that the annealing occurs under standard conditions (50 nM of primer concentration, pH ~7.0, and 50 mM Na+).
All of the above methods give an approximate value for Tm. Aside from nucleotide content, Tm is also influenced by salt concentration, sequence length, DNA sequence, presence of specific ions, and chemical additives (e.g. DMSO).
References
- Panjkovich, A., & Melo, F. (2005). Comparison of different melting temperature calculation methods for short DNA sequences. Bioinformatics, 21(6), 711-722.
- Prezioso VR. General notes on primer design in PCR. BioSyst. Lab., Brinkmann Instrum. Inc., Westbury, NY, USA, Tech. Rep. 2006.
- Oligo Calc: Oligonucleotide Properties Calculator
This work is licensed under a Creative Commons Attribution 4.0 International License
